List of positive and negative ME & CFS-related studies
From ME/CFS Wiki
Encyclopedia | Forum | Main Page | XMRV & MRV's
This is a list of all ME or CFS studies into XMRV & MLV-related viruses.
Positive Studies
Peer-reviewed Publications
1. WPI, Cleveland Clinic & NCI Study - Lombardi et al.
- Blinded
- Positive for XMRV in 68 of 101 patients (67%) as compared to 8 of 218 (3.7%) healthy controls.
- Method: 5 methods employed. Most sensitive blood-based assays for detection of XMRV in decreasing order:
- Nested PCR for gag sequences from LNCaP cells that have been co-cultured with subject’s plasma or activated PBMCs
- Presence of antibodies to XMRV Env in subject’s plasma
- Presence of gag products by nested PCR on stimulated PBMCs or detection of viral proteins expressed by activated PBMCs with appropriate antisera.
- Nested RT-PCR of plasma nucleic acid or PCR from cDNA from unactivated PBMCs
- PCR of DNA from unactivated PBMC prepared from subject’s blood.
- Urismans primers were set for VP-35 gag. The WPI used different outers to begin with and kept the same cycling conditions as Urisman et al.
- RT-PCR: everything was as per Urisman et al. except that they used the same primer sequence for both inners and dropped the annealing temperature, so that the gibbs free energy for template primer fromation would be more negative. This is called lowering the stringency of the primers.
- Nested PCR Gag primers: first round: GAG-O-F/GAG-O-R; second round: GAG-I-F (F603)/GAG-I-R (R1015)
- Env primers: 5922F and 6273R were forward and reverse primers.
- XMRV confirmed in 7/11 WPI CFS samples at the Cleveland Clinic (PCR-amplifying and sequencing segments of XMRV env and gag in CFS PBMC DNA)
- XMRV >99% similar to those reported for prostate tumor–associated strains of XMRV (VP62, VP35, and VP42)
- Serology: Applied to PMBC's after 42 days
- Negative controls were included in every experiment. [1]
- Sodium heparin blood tubes.
- Patient Definition: Fukuda and Canadian
- Sporadic patients from 12 US States & Canada (76/101) [2]
- Incline Village Outbreak (25/101)
- Science (8 October 2009)
- 'Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue Syndrome'
- Urge researchers not to rely solely on DNA PCR on unactivated PBMCs [3]
- Some patients have now been found to have XMRV and PMRV sequences. [4]
- Bagni did a phylogenetic analysis and found that many of the Lombardi et al. samples also contain Polytropic sequences, XMRV (P). One patient also had a modified polytropic, and was severely sick. [5]
2. NIH & FDA Study - Lo et al.
- Blinded.
- MLV-like virus gag gene sequences in 32 of 37 (86.5%) compared with only 3 of 44 (6.8%) healthy volunteer blood donors.
- Method: Nested PCR.
- Previously Reported PCR Primer Sets: first round: 419F/1154R; second round: GAG-I-F/GAG-I-R (Used by Lombardi et al. & Urisman A, et al.)
- In-House–Designed PCR Primer Sets: first round: 419F/1154R; second round: NP116/NP117
- Patient Definition: Holmes & Fukuda for 21, Holmes for 4, and unknown for 12.
- PNAS (23 August 2010)
- 'Detection of MLV-related virus gene sequences in blood of patients with chronic fatigue syndrome and healthy blood donors'
- Ruscetti retested the 9 samples tested 15 years later and isolated XMRV. [6]
- Bagni retested the 9 samples tested 15 years later and showed an immune response. [7]
- Subsequently 9/9 samples tested 15 years later were positive for antibody response. (Not published in Lo et al) [8]
Conference and Workshop Presentations and Posters
Positive studies presented at XMRV workshop [9]
- 'Is the mechanism of systemic immune activation in XMRV positive CFS patients similar to that observed in HIV ?' K. De Meirleir, K. Metzger, M. Fremont, C. Roelant (Belgium)
- 'XMRV detection in a national practice specializing in chronic fatigue syndrome (CFS)' Paul Cheney (USA, Canadian, Australian patients)
- 'XMRV in Chronic Fatigue Syndrome: A Pilot Study' M.R. Hanson, L.L. Lee, L. Lin, D.E. Bell, D. Ruppert, D.S. Bell (USA. Cornell University)
- 'Detection of infectious XMRV in the peripheral blood of chronic fatigue syndrome patients in the United Kingdom' Mikovits, Bagni, Jones, Huang, Bertolette, Sadowski, Lombardi, Pfost, Hagen, Ruscetti (UK, WPI/NCI).
- 'Detection of infectious XMRV in the peripheral blood of children' M.A. Pfost, K.S. Hagen, F.W. Ruscetti, J.A. Mikovits (USA, Autism and 'CFS' children).
- 'Detection of XMRV sequences in EBV-transformed B cell lines' J. Blanco, J. Carrillo, E. Garcia, J. Areal, B. Clotet, C. Cabrera (Spain, IrsiCaixa) 70% patients [10]
Negative Studies
Peer-reviewed Publications
1. McClure & Wessely Study - Erlwein et al.
- Blinded but no healthy controls used, & negative controls (water)
- Negative for XMRV in 186 CFS patients. No controls used.
- Method: Nested PCR on whole blood DNA looking for gag sequences.
- Different primer sequences than Lombardi et al.
- Standard phenol-based organic deproteinisation procedure used to extract genomic DNA.
- Amplification of 600 ng of LNCaP cellular DNA added
- Positive control: VP62 XMRV clone (Provided by Dr R. Silverman, Cleveland Clinic)
- EDTA blood tubes
- Banked blood samples
- Patient Definition: Fukuda
- Plosone (6 January 2010)
- 'Failure to Detect the Novel Retrovirus XMRV in Chronic Fatigue Syndrome'
2. Kerr, Stoye, Bishop, Gow Study - Groom et al.
- Blinded
- Negative for XMRV in 170 CFS patients and 395 controls.
- Method: PCR & RT-PCR in PBMC DNA looking for gag and env sequences.
- Also used a neutralizing viral assay. (The 26 positive samples also neutralized env proteins of other virus, and were therefore not specific)
- PCR Primer set for gag: first round same as Lombardi, but no second round (419F/1154R)
- RT-PCR Primer sets for env.
- 6173 env F (GGCATACTGGAAGCCATCATCATC) and 6173 env R (CCTGACCCTTAGGAGTGTTTCC) 6173 env probe (ATGGGACCTAATTTCC)
- 6682 env F (GTGCTGGCTGTGTCTAGTATCG) and 6682 env R (GCAGAGGTATGGTTGGAGTAAGTAC) 6682 env probe (ACGGCCACCCCTTCGT)
- Assay capable of detecting 16 copies of XMRV DNA
- EDTA blood tube for DNA preparation; a Paxgene tube for RNA preparation and a plain tube for serum preparation from clotted blood.
- Banked blood samples
- Positive control: VP62 XMRV clone (Provided by Dr R. Silverman, Cleveland Clinic)
- Patient Definition: Fukuda
- Retrovirology (15 February 2010)
- 'Absence of xenotropic murine leukaemia virus-related virus in UK patients with chronic fatigue syndrome'
3. Van der Meer, BMJ Study - Van Kuppeveld et al.
- Negative for XMRV in 32 patients and 43 controls.
- Method: RT-PCR (targeting the XMRV integrase gene) & Nested PCR. (targeting the XMRV gag gene) on PBMC DNA.
- Nested PCR Primer set for gag: first round Urisman et al., second round was own design.
- Assay capable of detecting 10 copies of XMRV DNA per 10^5 of PBMC
- Banked blood samples
- Patient Definition: Oxford
- BMJ (25 February 2010)
- 'Prevalence of xenotropic murine leukaemia virus-related virus in patients with chronic fatigue syndrome in the Netherlands: retrospective analysis of samples from an established cohort'
4. CDC, Robert Koch Institute, Blood Systems Research Institute Study - Switzer et al.
- Blinded
- Negative for XMRV in 51 CFS patients and 56 healthy persons.
- Method: 2 Nested PCR on DNA gag and pol, Plasma also examined & Western blot assay
- Method: ELISA done by Robert Koch Institute (Weak positive in 1/51 cases & 1/53 controls)
- Method: 2nd Nested PCR gag assay at Blood Systems Research Institute (Negative in 50 cases & 56 controls)
- Nested PCR gag: Previously Reported PCR Primer Sets: first round: 419F/1154R; second round: GAG-I-F/GAG-I-R (Used by Lombardi et al. & Urisman A, et al.)
- Nested PCR pol: first round: XPOLOF/XPOLOR; second round XPOLIF/XPOLIR
- ELISA Positive control: Goat polyclonal MuLV whole virus antisera
- ELISA Negative control: Human serum obtained from a healthy volunteer previously determined to be seronegative
- 2nd Nested PCR gag: first round 419F/1154R; second round: 488F/1107R (Sensitivity: 3 copies per reaction)
- Positive control: VP62 XMRV clone (Provided by Dr R. Silverman, Cleveland Clinic)
- CPT Vacutainer tubes containing sodium citrate and a blood separation reagent. PAXgene tubes & EDTA Vacutainer tubes. (Different blood tubes to Lombardi et al.)
- Assay capable of detecting 10 copies of XMRV DNA
- Banked blood samples
- Patient Definition: Empiric definition
- Retrovirology (1 July 2010)
- 'Absence of evidence of Xenotropic Murine Leukemia Virus-related virus infection in persons with Chronic Fatigue Syndrome and healthy controls in the United States'
5. Chinese Study - Ping Hong et al.
- Negative for XMRV in 65 CFS patients, 65 healthy controls, and 20 controls with Hep B, Hep C, HIV-1, or HTLV.
- Method: Multiplex real-time PCR or RT-PCR.
- RT-PCR gag primer sets: first round: (nt 462-523)
- Looking for proviral DNA in PBMCs, or viral RNA in plasma.
- Multiplex real-time PCR assay capable of detecting 20 copies/reaction of XMRV DNA (10 copies/μl × 2.0 μl XMRV DNA standard per reaction, or 10 IU/mL)
- Banked blood samples
- PBMCs and plasma were isolated immediately from Whole blood
- Patient Definition: Fukuda
- Virology Journal (13 September 2010)
- 'Failure to detect xenotropic murine leukaemia virus-related virus in Chinese patients with chronic fatigue syndrome'
6. USA Study - Henrich et al.
- Blinded.
- Negative for XMRV in 293 patients. (CFS 32, HIV 43, rheumatoid arthritis 97, hematopoietic stem-cell or solid organ transplant 26, or a general cohort of patients presenting for medical care 95.)
- Method: Nested PCR on PBMC gag DNA
- Nested PCR's gag primer sets x 3: first round: Lombardi et al. ; second round: either Erlwein et al. or Urisman et al. or own hBG.
- DNA extracted from at least 5 x 10^6 PBMCs (Qiagen).
- 10mL of whole blood collected for peripheral blood mononuclear cell (PBMC) isolation and XMRV PCR testing.
- Isolate VP62 (Provided by Dr R. Silverman, Cleveland Clinic).
- 10 copies of XMRV per 200 ng of PBMC DNA (control XMRV plasmid added), and 1 copy of XMRV DNA in 2 of 3 assays (VP62 plasmid added.)
- Patient Definition: Empiric definition (Completed a questionnaire & chart review.)
- J Infect Dis. (11 October 2010)
- 'Xenotropic Murine Leukemia Virus–Related Virus Prevalence in Patients with Chronic Fatigue Syndrome or Chronic Immunomodulatory Conditions'
7. USA Study - Oakes et al.
- Contaminated study
- 112 CFS patients & 36 healthy
- TaqMan qPCR assay for XMRV pol on PBMC DNA: All samples negative
- TaqMan qPCR assay for XMRV pol on PBMC DNA: WPI-1282 (Provided by WPI, resulted in detection of XMRV down to 10-12 pg, equivalent to two cells of 5 μg control DNA)
- TaqMan qPCR assay for XMRV pol on PBMC DNA: Failure to detected suggested as either XMRV-negative samples, or more divergent MLV sequences.
- Nested PCR for XMRV gag: Test could detect in 2-3 pg of WPI- 1282 DNA, equivalent to <1 cell, when mixed with 200 ng control DNA
- Nested PCR for XMRV gag: On initial testing 19/36 healthy positive & 2/112 CFS positive.
- CFS cohort: banked samples collected and processed in 2005.
- Healthy controls recruited between November of 2009 and May of 2010.
- Tests for mouse DNA contamination revealed correlation with viral sequences.
- All samples that tested positive for XMRV and/or MLV DNA were also positive for the highly abundant intracisternal A-type particle (IAP) long terminal repeat and most were positive for murine mitochondrial cytochrome oxidase sequences.
- No contamination in any of the negative control samples, containing those with no DNA template, which were included in each assay.
- Patient Definition: Fukuda (majority completely disabled)
- Retrovirology (20 December 2010)
- 'Contamination of human DNA samples with mouse DNA can lead to false detection of XMRV-like sequences'
8. Germany Study - Hohn et al.
- Blinded.
- Negative for XMRV in 39 CFS patients, 112 MS patients, & 40 healthy donors.
- Method: 2 x Nested PCR in cultured PBMC DNA
- Method A: Nested PCR on Co-culture of PBMC with LNCaP cells (targeting XMRV gag gene)
- Method B: Nested PCR on Provirus PCR in cultured PBMC with with IL-2 and PHA (targeting XMRV gag gene)
- Method: XMRV Gag ELISA and XMRV Env ELISA
- Env ELISA already shown to not work in Hohn et al. (2009, prostate cancer study) and Switzer et al. (2010, CFS - CDC study)
- Gag ELISA is new and untested.
- ELISA assay not validated against XMRV positive human specimen.
- ELISA validated against goat polyclonal anti-MuLV gp70 antisera and corresponding goat control sera (In Switzer et al.). Not a positive clinical sample.
- ELISA tested on 36 CFS, 112 MS, 27 healthy.
- Nested PCR in cultured PBMC: cultured with PHA & IL-2 for 7 days.
- Nested PCR in cultured PBMC: tested on 39 CFS, 50 MS, 30 healthy.
- One of the Nested PCR in cultured PBMC was used by Urisman et al. (no data given)
- One of the Nested PCR in cultured PBMC on gag was used by Hohn et al. (negative prostate cancer study)
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: Tested on 10 CFS & 10 healthy
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: Supernatant from chronically infected 22Rv1 cells was added to separate LNCaP cell cultures as a positive control.
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: Cultured for 7 days
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: PBMC did not transmit XMRV to the LNCaP cells
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: Incubation with 22Rv1 supernatant resulted in the expected infection of the indicator cells
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: Contamination ruled out using PCR (B. Klempa) and nested PCR (10 copies of the pcDNA3.1-VP62 plasmid in 200ng of human DNA)
- Nested gag PCR on Co-culture of PBMC with LNCaP cells: water-only control
- Heparinized blood samples were processed to yield PBMCs by density gradient centrifugation using Ficoll-Hypaque and cryopreserved until analysis.
- Infection of PBMCs with XMRV: Showed PBMC cultures can be experimentally infected by XMRV, resulting in the release of low levels of transmittable virus.
- Nested PCR detects 10 proviral XMRV sequences in 200-800ng of human DNA, and as 200ng DNA corresponds to a genome equivalent of about 33,300 cells (6pg DNA/cell), the test, performed in duplicate, has a detection limit of one provirus in at least 3,300 PBMC.
- Patient Definition: Fukuda
- PLoS One (22 December 2010)
- 'No Evidence for XMRV in German CFS and MS Patients with Fatigue Despite the Ability of the Virus to Infect Human Blood Cells In Vitro'
9. USA Study - Schutzer et al.
- Blinded, but no controls.
- Testing cerebrospinal fluid (CSF) for XMRV & other viruses.
- Negative for XMRV in 43 CFS patients.
- 2 PCR methods used, one for other viruses & one for XMRV.
- Method for other viruses: Broad Range PCR/ (Electrospray Ionization Mass Spectrometry (PCR/ESI-MS)
- Ibis Sterile Fluids Viral assay (Athogen.com) consisting of primer pairs targeted to Human Adenoviruses11, Alphaviruses12, Herpes viruses (HHV 1, 2, 3, 4, 5, 8), Human Parvovirus B19, Dengue viruses 1-4, WNV, JEV, SLE, Enteroviruses A-D, and Coxsackieviruses.
- Method for XMRV on gag & env: RT-PCR, with Lombardi primers (Do not state which of the two) and own set. (Again not in blood, but CSF)
- Culture with LNCaP
- Used 100 microlitres, Lombardi et al used 8mL of blood. (Typical amount for lumbar puncture for virological analysis is about 10ml)
- Positive control: VIPDx laboratory native controls, previously found to be XMRV positive. Yet this sample is blood, not CSF.
- Negative control: distilled water.
- Patient Definition claimed to be Fukuda, but description is Empiric definition
- Annals of Neurology (4 February 2011)
- 'Analysis of cerebrospinal fluid from chronic fatigue patients for multiple human ubiquitous viruses and XMRV'
10. USA Study - Satterfield et al.
- Blinded.
- Negative for XMRV & MuLV in 45 CFS cases and in 42 persons without CFS
- PCR on PBMC DNA pol x 2: Real-time PCR on pol & Nested PCR on pol.
- Nested PCR on PBMC DNA gag
- Nested PCR only used on a subset of specimens - 28 samples from “severe CFS” persons, 11 “unclassified CFS” and 9 controls.
- Fresh, EDTA-treated blood specimens from 30 CFS cases from 17 states - recruited via online announcement.
- Fresh, Heparin-containing tube from 1 CFS case.
- Another 14 self-diagnosed CFS samples from persons having a severity score above 50 (Bell Scale) or having an unreported CFS severity (unclassified CFS)
- Of the 31, 26 were diagnosed by a doctor, 5 self diagnosed.
- Positive control for Real-tiime PCR on pol: DNA from the XMRV-infected 22Rv1 cell line.
- Positive control for Nested PCR on pol & gag: XMRV(VP62) plasmid - This assay has been shown by Danielson et al. to not find pol or gag in those known to be infected. (600ng of DNA is also needed)
- RT-PCR on XMRV gag, & qRT-PCR on MuLV gag and XMRV gag in plasma: 48 samples tested (new assays, & it is negligible that one viral sequence would be present with the RT assay that isolated RNA from 62ul of plasma and use of 0.25ul of cDNA)
- Both RT-PCR tests detect between 10 – 25 copies of XMRV (VP62) RNA in plasma.
- Western Blot on plasma for env & gag. (New assay, which is 400% less sensitive that PCR in detecting XMRV antibodies in blood of health people - Qui et al.)
- Western Blot tested on 3 infected macaques. (New assay)
- Serology: Not cultured.
- Fukuda definition (32) and unknown (14), and using Bell CFS Severity scale.
- No evidence any patient had PEM.
- Samples from 20 USA states.
- Retrovirology (22 February 2011)
- 'Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses'
11. UK Study - Erlwein et al.
- Not blinded for PCR, but water controls.
- Blinded for serology.
- Negative for XMRV in 48/186 samples previously described in Erlwein et al. (2010)
- Negative for MRV's antibodies in 130 patients & 30 normal healthy subjects.
- PCR on XMRV gag using primers 419F and 1154R
- PCR on XMRV env using primers 5922F and 6273R
- Serology: 130 patients & 30 normal healthy subjects (NHS) as controls were assayed blind using 2 ELISA's (no ELISA has ever detected MRV's)
- ELISA 1: looked for antibody response to antibody to the xenotropic NZB retrovirus envelope protein gp70, based on antibodies against the NZB virus (NZB MULV has only 67% homology to XMRV, and was used by Hohn)
- ELISA 2: looked for antibody response to antibody to the xenotropic NZB retrovirus envelope protein gp70, based on antibodies against the ecotropic Rauscher MLV (NZB MULV has only 67% homology to XMRV, and was used by Hohn)
- Schalberg et al. demonstrated that antibodies specific for gp70 did not produce a precipitate as measured by Western Blot in XMRV positive patients. Sandra Ruscetti had reported the same.
- Positive control: VP62 XMRV clone (Provided by Dr R. Silverman, Cleveland Clinic)
- Negative control: Six no-template (water) controls
- EDTA blood tubes
- Whole blood
- Banked blood samples
- Patient Definition: Fukuda
- Plosone (14 March 2010)
- 'Investigation into the Presence of and Serological Response to XMRV in CFS Patients'
12. Japan Study - Furuta et al.
- Follow up to the pilot study Sato et al.
- Minor Ab positivity for XMRV in 100 CFS patients, 67 prostate cancer patients, and 500 healthy blood donors
- Antibody-Gag screening by immunoblot analysis
- 12 positive plasma samples for Gag CA protein: 8 donors, 2 PC patients & 2 CFS patients
- Prevalence of XMRV calculated from the immunoblot assay was 1.6% in blood donors, 3.0% in PC patients, and 2.0% in CFS patients
- Immunoblot assay against proteins from Moloney murine leukemia virus (MoMLV - 83% amino acid homology in the Gag region with XMRV)
- MoMLV assay - positive in 1.0% in the donors, 1.5% in PC patients, and 1.0% in CFS patients
- No XMRV genes in the blood of any CFS patients.
- None of those testing positive retained strong Ab responses to multiple XMRV proteins.
- April 2008 - Nested RT-PCR XMRV RNA from plasma: 1/2 PC patients positive (Sequences were 99.8% identical to that of XMRV VP62) did not contain an XMRV-specific 24 nucleotide deletion in the gag region
- Patient Definition: Fukuda
- Retrovirology (17 March 2011)
- 'No association of Xenotropic Murine Leukemia Virus-related virus with prostate cancer or chronic fatigue syndrome in Japan'
13. USA Study - Shin et al.
- Blinded
- Negative for XMRV & related MLVs in 100 people with CFS & 200 self-reported health controls.
- 14 patients from the WPI - 2/14 positive in Lombardi et al.
- Method: 4 TaqMan qPCR assays, Nested PCR, ELISA, Western blots & culture.
- Nested PCR: Primes not given, but references Lo et al. Two modifications claimed to have been made to this, 1.0 U of Platinum Taq (not 0.5 U) and added dUTP to the mastermix to prevent subsequent PCR contamination with amplicons.
- qPCR x 4: PBMCs (45 cycles) Positive control reactions were reliably positive for 50 and 5 copies of XMRV plasmid DNA.
- LTR: 47F (5’- AATAAAGCCTTTTGCTGTTTGCA-3’), 109R (5’- GAGGAGACCCTCCCAAGGAA-3’), and 74MGB (5’-6FAM-AAGCGTGGCCTCGC-MGB-3’).
- GAG: 505F (5’- GAATTTTTGCTTTCGGTTTTACG-3’), 663R (5’-TCCCCAGTGCTGCAAGGT-3’), and 618MGB (5’-TET- ACAGACCGTAACTACC-MGB-3’).
- POL: 4552F (5’- CGAGAGGCAGCCATGAAGG-3’), 4616R (5’- GCGTATACGGGGTTGAGTCC-3’), and 4572MGB (5’-6FAM-AGTTCTAGAAACCTCTACACTC-MGB-3’).
- ENV: 6356F (5’- GGATGCCCCCAAAACATG-3’), 6441R (5’- GGACCTGGCGGGTCAGA’3’), and 6393MGB (5’-6FAM- TCCACTGGGGCCGAC-MGB-3’).
- XMRV SU recombinant protein: Forward primer with XhoI site 5’-ATTATCCTCGAGCAACGTGACAGCCCTCAC-3’ and reverse primer with HindIII site 5’-ATTATCAAGCTTCTTTTCAAACTGGCCATAAA-3’ were used to PCR amplify SU from pXMRV1.
- XMRV SU recombinant protein: Forward primer with NheI site 5’- ATTATCGCTAGCTACTGAATGGCGCGTTCA-3’ and reverse primer with XhoI site 5’- ATTATACTCGAGGGAGCCGGGCGAAGCAGTA-3’ were used to PCR amplify the signal peptide (SP) from pNCA.
- ELISA with human sera - No ELIDA has ever detected XMRV.
- Western blot (WB) assays with human sera.
- Culture: Done on 31 patients & 34 healthy volunteers.
- Culture: Not the same as that used in Lombardi et al (2009).
- Culture: 13 negative controls and 2 positive controls.
- Culture: Analysed by WB & qPCR for XMRV.
- WPI patients: tested with 4 x qPCR, ELISA, Western Blots.
- WPI patients: Claim to have been retested with previous assays
- WPI patients: Shin et al used single round PCR for gag from Lombardi et al, but Lombardi et al used Nested RT-PCR. Shin et al used Nested PCR for gag from Lo et al, but Lo et al used Nested RT-PCR.
- WPI patients: Culture said to be same as Lombardi et al.
- Positive control: pXMRV1 plasmid DNA
- Negative control: Water
- Conditions: 50°C for 2min, 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min
- qPCR pol: 5 viral copies of pXMRV1 DNA
- qPCR LTR: 5 copies of XMRV plasmid DNA in a background of 400 ng of human placental DNA, and the assay was linear over a large range, viz. 5000 to 5 copies of viral DNA.
- qPCR gag: 5 viral copies with an average of 3 cycles delay in crossing the threshold (threshold cycle, Ct, see Fig. 2C) - env & pol similar.
- Mouse contamination: Nested PCR on DNA: 5% samples, both patient & health, positive for product of expected size. - Lombardi et al did not use Nested PCR (Lombardi et al used Nested RT-PCR on RNA).
- Mouse contamination: qPCR assay used to test if 5% was the plasmid - it was not.
- Mouse contamination: qPCR IAP assay (based on that used in Oakes et al) - samples found negative for mouse.
- Mouse contamination: 36 replicates of genomic DNA from unifected LNCaP cells tested with Nested PCR - 3 positive. Sequencing revealed MLV-related sequences. (95 - 100% similar to those published in Lo et al)
- Mouse contamination: Recombinant Taq polymerase (Invitrogen) and Platinum Taq polymerase (Invitrogen) tested positive for IAP sequences. (Mouse DNA detected in Nested PCR kits - causing false positive results)
- Fresh blood (Collected by ARUP Laboratories, Salt Lake City, Utah)
- 8.5ml vacutainer tubes (Becton-Dickinson): 159 2 EDTA and 1 serum separator.
- Patient Definition: Fukuda followed by Canadian (105 had been enrolled, 5 did not meet the Canadian Consensus Definition )
- Only 2 of the patients from the 14 WPI positives were also in Lombardi et al. [11]
- All patients & controls were from the Salt Lake City area.
- Journal of Virology (4 May 2011)
- 'Absence of XMRV and other MLV-related viruses in patients with Chronic Fatigue Syndrome'
14. USA Study - Knox et al.
- 1/61 positive, but that 1 declared negative - no reason given. (Western blot only used on one patient)
- Only 7 healthy controls used for inactivation study (7 healthy UCSF laboratory workers)
- 61 patients from Sierra Internal Medicine
- 43 claimed to have been previously identified as XMRV-positive
- 2 groups of patients: P1 & P2
- P1: 41 patients
- P2: 29 patients
- P1 & P2: 9 patients in both groups
- No idea where this evidence came from for people being positive or negative, and to which variant?
- P1: 37/41 claimed to have previously been tested (WPI or VIPdx - who also diagnose other variants, not just XMRV)
- P1: 26 claimed as XMRV positive, 11 negative.
- P1: archived diagnostic specimens and, therefore, exempt from IRB consideration [46.101 (b)(4), Code of Federal Regulations].
- P2: selected largely on the basis of a previous positive diagnosis for XMRV infection.
- P1 - Nested PCR for XMRV on PBMCs: P1 group looking at peripheral blood leukocytes
- P1 - Nested PCR for XMRV on PBMCs: Primers gag (419F/1154R and 445F/870R) and env (primers 5922F/6273R and 5937F/6198R) - Not Lombardi et al. nested primers.
- P1 - Nested PCR for XMRV on PBMCs: Analytical sensitivity - at least 0 XMRV genomes per reaction (table S3).
- P1 - Nested PCR for XMRV on PBMCs: 0/19 positive
- P1 - claimed chart review: 10/19 positive at VIPDx using Lombardi methods.
- P2 - RT– PCR on PBMCs (Claimed primers & protocols same as Lo et al.)
- P2 - RT-PCR on plasma
- Positive control for P1 group tests - XMRV/VP62 plasmid of gag & env, engineered with substitutions to distinguish it from wild type XMRV-sequences. (EF185282 - Dong et al)
- Positive control: 22Rv1/XMRV fragment (Analytical sensitivity of at least 10 copies of XMRV gag DNA per reaction, second-round PCR detected 1-10 copies/reaction (table S3).
- Culture 1: Used mink lung cells (not LNCaP) for only 3 days.
- Culture 2: PHA stimulation for 3 weeks, but no IL-2 (which is needed for proper culture conditions)
- Fresh blood samples were used for viral culture and testing.
- Antibodies: 60 Plasma from P1 & P2
- Antibodies: 2 CMIAs used for other MLVs (using either transmembrane p15E or envelope gp70 recombinant proteins of XMRV - from this Qiu et al. [12])
- Antibodies: 0/60 reactive in p15E CMIA
- Antibodies: 1/60 reactive in gp70 CMIA
- Antibodies: 1/60 reactive in gp70 CMIA was retested with Western blot (WB) assay. Reported as negative, but was positive.
- Inactivity by sera: On patients from group P2
- Inactivity by sera: 7 healthy UCSF laboratory workers served as controls.
- Inactivity by sera: Can serum samples inactivate X-MLV and XMRV (22Rv1/XMRV).
- Inactivity by sera: Mixed X-MLV and XMRV, with heated or unheated sera from 7 healthy & 19 patients.
- Inactivity by sera: Both viruses were susceptible to inactivation by unheated, complement-containing sera from both groups; XMRV was less susceptible to inactivation than X-MLV
- Inactivity by sera: Results showed restriction of XMRV replication in human cells
- Screen reagents for contamination: MLV sequences in 3/5 Taq polymerases that utilize MAbs. Also in 9/17 other MAbs-containing reagents used in research laboratories (table S2) including antibodies to CD4, CD8, and CD14.
- Fukuda definition used, but no infrmation on whether they were also met the Canadian.
- Science (31 May 2011)
- 'No Evidence of Murine-Like Gammaretroviruses in CFS Patients Previously Identified as XMRV-Infected'
Quick Reference Table of XMRV Studies
Notes
VP62 strain of XMRV is actually a full-length, replication-competent clone.
